Архив рубрики «My Latin Bride»

Chicken Linkage Mapping. Genetic mapping ended up being done at one of many couple internationally respected chicken mapping populations…

Chicken Linkage Mapping. Genetic mapping ended up being done at one of many couple internationally respected chicken mapping populations…

Hereditary mapping ended up being carried out in one of several a couple of internationally respected chicken mapping populations, each eastern Lansing guide household. The household is created increase by wyoury out of get a cross around one Jungle Fowl sire plus White Leghorn dam, followed closely by backcross in between any F1 men to four White Leghorn women (15). Fifty-two F2 progeny with our backcross are genotyped at markers characterized within learn, plus linkage analysis had been done using map supervisor, variation 2.6.5 (sixteen), as well as mapmaker, adaptation 3.0 (17), towtherds a collection of most 890 markers already entered each pedigree (eighteen). Limit fragment extent polymorphism (RFLP) research for the CHD1Z gene ended up being finished with your probe at Jungle Fowl DNA, amplified with PCR, through the use of primers 2895 (CGGCTAGTCACAAAAGGATC) to 3225 (TTGAACTGTGAAAGCAACTC) which were hybridized towards HindIII-digested DNA. Прочитать остальную часть записи »

Теория великолепия
Ваш e-mail: *
Ваше имя: *
Подписчиков:
КОНТАКТЫ
SKYPE Gulnara_Uspeh e-mail gulnara_uspeh@mail.ru
Рубрики